Syndrome de Lynch

Le cancer colorectal est le deuxième cancer le plus fréquent en France. 36000 nouveaux cas sont recensés chaque année. Les principaux facteurs de risques de cette affection sont le caractère héréditaire, les maladies inflammatoires du tube digestif (Maladie de Crohn et Recto-Colite Ulcéro-Hémorragique) et peut-être des habitudes alimentaires favorisant les aliments riches en viande et pauvres en fibre. Ce dernier point reste toutefois débattu car il n’y a pas de démonstration dans la littérature que l’augmentation d’apport de fibres et la diminution des apports carnés modifie le risque de survenue de cancer.

En revanche, le caractère héréditaire est maintenant connu depuis de très nombreuses années. En effet, dès le début du 20ème siècle à l’Université du Michigan, le Docteur WARTHIN a pu démontrer que les patients présentant un cancer avaient dans 15% des cas dans leurs antécédents un parent ayant déjà développés un cancer. Beaucoup d’épdiémiologistes Américains dont le Docteur LYNCH ont pu étudier un certain nombre de familles au sein desquelles la survenue de cancer était particulièrement fréquente. Ces descriptions avec le temps ont amené à la constitution de critères qui permettaient de trouver les familles particulièrement à risque de développer des cancers et notamment au niveau du côlon et du rectum pour mener des recherches en vue de connaître la raison de cette hérédité. Ces critères établis en 1991 à Amsterdam ont alors pris le nom de cette capitale.

Amsterdam 1991 (ICG-HNPCC)

  1. Cancers colorectaux chez 3 membres de la même famille, 1 parent au premier degré avec les 2 autres.
  2. 2 générations au moins atteintes
  3. 1 cas avant 50 ans

C’est en 1993 de façon fortuite, qu’une modification perceptible uniquement en biologie moléculaire au sein de certaines tumeurs que les explications responsables du syndrome HNPCC/LYNCH ont pu être mises en évidence.

1 – Le phénotype MSI
Cette anomalie a été décrite en même temps par 3 équipes de recherches américaines et a gardé la dénomination de micro-satellites instability (MSI).

Figure 1.

1-a – Les micro-satellites
Au sein de l’ADN de tout être vivants des répétitions d’acides nucléiques sont retrouvées.

5’ATGGTCATGTAGCTGGATGTGTGTGTGTGTGTGTATCGTAC 3’
3’TACCAGTACATCGACCTACACACACACACACACATAGCATG 5’

            Ces répétitions facilement identifiables sont appelés micro-satellites. Au sein d’individu donné, toutes les cellules présentes les mêmes micro-satellite (même nombre de répétition pour chacun d’entre eux). En revanche d’un in,dividu à l’autre, ils sont différents. La police scientifique se sert d’ailleurs de ces caractéristiques pour déterminer si les prélèvements biologiques retrouvés sur les scènes de crime correspondent à ceux d’un suspect (figure 1).Le suspect numéro 1 semble présenter des microsatellites identiques à ceux retrouvés sur la scène du crime… 

 

 

Les micro-satellites ont aussi été utilisés pour déterminer si au sein des tumeurs il y avait des anomalies que l’on ne retrouvait pas au sein des cellules normales. Lorsque ces expériences étaient menées, dans 15% des cas, ces micro-satellites s’avéraient au sein des tumeurs ne plus avoir une longueur identique alors qu’ils venaient des cellules d’un même individu. Ainsi, on considérait que ces micro-satellites étaient instables (Figure 2).

Figure 2 : Résultats d’une PCR montrant la différence de longueur de microsatellite. N : tissu normal (non tumoral) T : tissu tumoral. Dan le cercle rouge, il y a plus de traits que dans le tissu normal, montrant que les microsatellites ont perdu leur caractéristiques initiales.

Secondairement, l’explication de cette instabilité a pu être rapportée par la connaissance des mécaniques de réparation de l’ADN au sein des bactéries. Ainsi les gènes du système de réparation des mésappariements de l’ADN après réplication ont été mis en évidence, comme responsables de la survenue de ces anomalies au sein de ces tumeurs et des syndromes HNPCC/LYNCH.

2 –  Fonctionnement du système MMR

Quand une cellule prépare sa mitose (division d’une cellule pour en former deux), la cellule commence par faire une copie de son ADN (réplication de l’ADN). Lors de la réalisation de ces copies, un certain nombre de fautes sont commises. Ces fautes, si elles ne sont pas corrigées, pourraient entraîner des dysfonctionnements qui amèneraient le plus souvent à la mort de la cellule copiée. Il existe donc un mécanisme pour corriger ces fautes de copie, il s’agit du système de réparation des mésappariement de l’ADN après réplication ou en anglais le MISMATCH REPAIR (MMR). Succinctement ce système peut être rapidement évoqué. Une protéine, la protéine MSH2 reconnaît les fautes et s’associe alors à d’autres protéines et tout particulièrement à la protéine MLH1 pour réaliser la correction de la faute (Figure 3).

Si l’une de ces protéines (MSH2 ou MLH1) n’est pas présente pour faire la réparation, les fautes s’accumulent et la cellule peut alors soit mourir, soit devenir suffisamment anormale et entraîner l’apparition d’un cancer.

Page suivante : Diagnostic d’un syndrome de Lynch.